Jump to content
molekulerbiyolog

DNA Dizisindeki Palindromlar

Önerilen İletiler

molekulerbiyolog

DNA dizi analizini yeni öğrenenler ters tamamlayıcı zinciri anlamakta genellikle zorlanırlar. Aslında iki diziyi de normalde çok hızlı şekilde tanıyabilirsiniz.

ATGCTGATCTTGGCCATCAATG ve CATTGATGGCCAAGATCAGCAT

Aynı DNA molekülünün karşılıklı zincirlerini oluştururlar.

DNA tamamlayıcılarının en ilgi çekici özelliği, her iki tamamlayıcı zincir okunduğunda DNA’nın içerdiği dizilerin aynı bölgede benzer olmasıdır. Şekil 1-7 bu sihirli hileyi göstermektedir. Bu dizilere palindrom denir. Palindrom her iki yönde de aynı okunan cümle veya kelimeler için kullanılır, örneğin; “ Madam I’m Adam” veya “A man, a plan, a canal: Panama.”  Palindromik diziler sadece tuhaf değillerdir, önemli biyolojik roller üstlenmişlerdir. Örneğin; birçok DNA kesim enzimi (restriksiyon enzimi olarak ifade edlir) palindromik hedef dizilere sahiptirler.

Diğer palindromik diziler düzenleyici proteinlerin, genleri açıp kapattığı yerlerde bağlanma bölgesi gibi çalışırlar. Ayrıca palindromik diziler DNA moleküllerinin 3 boyutlu yapılarında da çok etkilidirler (sadece DNA’ da değil, gelecek bölümde göreceğimiz gibi RNA da da bir çok palindromik dizi etkilidir.)

İletiyi paylaş


İletiye bağlantı

Yorum yazmak için hesap oluşturmalı veya giriş yapmalısın.

Yorum yapmak için üye olmanız gerekiyor

Hesap oluştur

Hesap oluşturmak ve bize katılmak çok kolay.

Hesap Oluştur

Giriş yap

Zaten bir hesabınız var mı? Buradan giriş yapın.

Giriş Yap

Hakkımızda

Biyoloji Günlüğü ülkemizdeki biyoloji öğrencileri, mezunları ve çalışanları adına kar gütmeyen bir proje olarak 9 senedir faaliyetlerine yılmadan devam etmeye çalışan masum bir projedir. Lütfen art niyetinizi forumdan uzak tutunuz. Bize iletişim formu aracılığıyla ulaşabilirsiniz.

Dilerseniz biyolojigunlugu@gmail.com veya admin@biyolojigunlugu.com adresine mail de gönderebilirsiniz. Bizimle arşivinizi paylaşmak isterseniz wetransfer.com üzerinden biyolojigunlugu.com adresine dosya transferi olarak iletmeniz yeterlidir, sizin adınıza paylaşılacaktır.

Sitemiz bir "Günlük" olarak derleme yayın, yorum, diyalog ve yazılara vermektedir. Güncel biyoloji haberleri ve gelişmelere ek olarak özellikle sosyal medyada gözden kaçan, değerli gördüğümüz tüm içeriğe kaynak ve atıflar dahilinde sitemizde yer vermekteyiz. Bu sitede verilen bilgilerin kullanım sorumluluğu tümüyle kullanıcıya aittir. Sayfalarımızda yer alan her türlü bilgi, görsel ve doküman sadece bilgilendirmek amacıyla verilmiştir.

Biyoloji Günlüğü internet sitesi 5651 Sayılı Kanun’un 2. maddesinin 1. fıkrasının m) bendi ile aynı kanunun 5. maddesi kapsamında Yer Sağlayıcı olarak faaliyet göstermektedir. İçerikler, ön onay olmaksızın tamamen kullanıcılar tarafından oluşturulmaktadır. Yer Sağlayıcı olarak, kullanıcılar tarafından oluşturulan içeriği ya da hukuka aykırı paylaşımı kontrol etmekle ya da araştırmakla yükümlü değildir.

Yer Sağladığı içeriğin 5651 Sayılı Kanun’un 8 ila 9. maddelerine aykırı şekilde; kişilik haklarınızı ihlal ettiğini ya da hukuka aykırı olduğunu düşünüyorsanız mail adreslerimizden iletişime geçerek bildirebilirsiniz. 

Bildirimleriniz dikkatle ve özenle incelenmekte olup kişilik haklarınızın ihlali ya da hukuka aykırılığın tespiti halinde mevzuat kapsamında en kısa sürede işlem yaparak bilgi vereceğiz.

×
×
  • Yeni Oluştur...

Önemli Bilgilendirme

Kullanım Şartları, Gizlilik Politikası, Forum Kuralları sayfalarına göz atınız.