Jump to content
molekulerbiyolog

DNA Dizisindeki Palindromlar

Önerilen İletiler

molekulerbiyolog

DNA dizi analizini yeni öğrenenler ters tamamlayıcı zinciri anlamakta genellikle zorlanırlar. Aslında iki diziyi de normalde çok hızlı şekilde tanıyabilirsiniz.

ATGCTGATCTTGGCCATCAATG ve CATTGATGGCCAAGATCAGCAT

Aynı DNA molekülünün karşılıklı zincirlerini oluştururlar.

DNA tamamlayıcılarının en ilgi çekici özelliği, her iki tamamlayıcı zincir okunduğunda DNA’nın içerdiği dizilerin aynı bölgede benzer olmasıdır. Şekil 1-7 bu sihirli hileyi göstermektedir. Bu dizilere palindrom denir. Palindrom her iki yönde de aynı okunan cümle veya kelimeler için kullanılır, örneğin; “ Madam I’m Adam” veya “A man, a plan, a canal: Panama.”  Palindromik diziler sadece tuhaf değillerdir, önemli biyolojik roller üstlenmişlerdir. Örneğin; birçok DNA kesim enzimi (restriksiyon enzimi olarak ifade edlir) palindromik hedef dizilere sahiptirler.

Diğer palindromik diziler düzenleyici proteinlerin, genleri açıp kapattığı yerlerde bağlanma bölgesi gibi çalışırlar. Ayrıca palindromik diziler DNA moleküllerinin 3 boyutlu yapılarında da çok etkilidirler (sadece DNA’ da değil, gelecek bölümde göreceğimiz gibi RNA da da bir çok palindromik dizi etkilidir.)

İletiyi paylaş


İletiye bağlantı

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.

Misafir
Bu konuyu yanıtla

×   Yapıştırdığınız içerik biçimlendirme içeriyor.   Biçimlendirmeyi Temizle

  Only 75 emoji are allowed.

×   Adresiniz otomatik olarak yerleştirildi.   Display as a link instead

×   Önceki içeriğiniz geri yüklendi.   Editör içeriğini temizle

×   You cannot paste images directly. Upload or insert images from URL.


Hakkımızda

Biyoloji Günlüğü ülkemizdeki biyoloji öğrencileri, mezunları ve çalışanları adına kar gütmeyen bir proje olarak 9 senedir faaliyetlerine yılmadan devam etmeye çalışan masum bir projedir. Lütfen art niyetinizi forumdan uzak tutunuz. Bize iletişim formu aracılığıyla ulaşabilirsiniz.

Dilerseniz biyolojigunlugu@gmail.com veya admin@biyolojigunlugu.com adresine mail de gönderebilirsiniz. Bizimle arşivinizi paylaşmak isterseniz wetransfer.com üzerinden biyolojigunlugu.com adresine dosya transferi olarak iletmeniz yeterlidir, sizin adınıza paylaşılacaktır.

×
×
  • Yeni Oluştur...

Önemli Bilgilendirme

Kullanım Şartları, Gizlilik Politikası, Forum Kuralları sayfalarına göz atınız.